Journal: Frontiers in Cardiovascular Medicine

Article Title: Piezo1 Participated in Decreased L-Type Calcium Current Induced by High Hydrostatic Pressure via . CaM/Src/Pitx2 Activation in Atrial Myocytes

doi: 10.3389/fcvm.2022.842885

Figure Lengend Snippet: Protein expression levels of Cav1.2, Piezo1, CaM, and Src in human LAA tissues. (A) Representative western blots and densitometric analysis of Cav1.2 and Piezo1 proteins in LA tissues of AF patients and those with SR. (B) Representative western blots and densitometric analysis of CaM and Src protein in LA tissues of AF patients and those with SR. GAPDH was the internal control. ** p < 0.01. Values are presented as the mean ± standard error of the mean (SEM).

Article Snippet: According to standard protocols, the treated protein samples (15–30 μg) were separated by electrophoresis with 10% SDS–polyacrylamide gels and transferred to PVDF membranes, which were blocked with 5% non-fat milk for 1 h at room temperature and then incubated overnight at 4°C with primary rabbit polyclonal Abs against Piezo1, Cav1.2 (dilution, 1:1000; Alomone Labs, Jerusalem, Israel); and Src (1:1000; Abcam, Waltham, MA, USA;) and mouse polyclonal Abs against Pitx2 (1:1000; Cloud-Clone Corp., Wuhan, Hubei, China) and glyceraldehyde 3-phosphate dehydrogenase (GAPDH) or β-actin (1:5000; Cell Signaling Technology, Inc., Beverly, MA, USA).

Techniques: Expressing, Western Blot

Journal: Frontiers in Cardiovascular Medicine

Article Title: Piezo1 Participated in Decreased L-Type Calcium Current Induced by High Hydrostatic Pressure via . CaM/Src/Pitx2 Activation in Atrial Myocytes

doi: 10.3389/fcvm.2022.842885

Figure Lengend Snippet: Effects of hypertension on the incidence of AF, I Ca,L , and Piezo1 expression in Wistar rats and SHRs with and without Val treatment. (A) Representative baseline surface ECG and intra-atrial electrocardiogram (IAEG); (B) The incidence AF in Wistar rats and SHRs treated with and without Val treatment ( n = 8). ** p < 0.01 vs. Wistar rat; ## p < < 0.01 vs. SHRs. (C) Typical surface ECG recordings of rats with AF that spontaneously reverted to SR and typical disorganized amplification of atrial waves (f wave). (D) Representative traces of AP in atrial myocytes from Wistar rats, SHRs, and SHR + Val groups and a histogram of APD in atrial myocytes from each group ( n = 12–15 myocytes from 3–4 rats). * p < 0.05 vs. Wistar rat; # p < 0.05 vs. SHRs. (E) Representative traces of I Ca,L (pulse protocol, inset), corresponding current-voltage relationship, mean data for voltage dependence activation, inactivation, and time course of recovery current for I Ca,L in atrial myocytes of each group ( n = 8–14 myocytes from 3–4 rats). (F) Representative examples of immunohistochemical analysis of LA tissues from Wistar rats and SHRs treated with and without Val using Ab against Piezo1. Scale bar, 20 μm. (G) Representative western blots and densitometric analysis of Cav1.2, Piezo1, CaM, and Src in LA tissues of Wistar rats and SHRs. GAPDH was the internal control. Values are presented as the mean ± SEM.

Article Snippet: According to standard protocols, the treated protein samples (15–30 μg) were separated by electrophoresis with 10% SDS–polyacrylamide gels and transferred to PVDF membranes, which were blocked with 5% non-fat milk for 1 h at room temperature and then incubated overnight at 4°C with primary rabbit polyclonal Abs against Piezo1, Cav1.2 (dilution, 1:1000; Alomone Labs, Jerusalem, Israel); and Src (1:1000; Abcam, Waltham, MA, USA;) and mouse polyclonal Abs against Pitx2 (1:1000; Cloud-Clone Corp., Wuhan, Hubei, China) and glyceraldehyde 3-phosphate dehydrogenase (GAPDH) or β-actin (1:5000; Cell Signaling Technology, Inc., Beverly, MA, USA).

Techniques: Expressing, Amplification, Activation Assay, Immunohistochemical staining, Western Blot

Journal: Frontiers in Cardiovascular Medicine

Article Title: Piezo1 Participated in Decreased L-Type Calcium Current Induced by High Hydrostatic Pressure via . CaM/Src/Pitx2 Activation in Atrial Myocytes

doi: 10.3389/fcvm.2022.842885

Figure Lengend Snippet: Effect of HHP on the depression of I Ca,L in HL-1 cells. (A) Representative traces of AP in HL-1 cells under various hydrostatic pressures (0, 20, and 40 mmHg) for 24 h. APD 50 , APD 70 , and APD 90 of HL-1 cells were calculated ( n = 9, 10, and 7 at 0, 20, and 40 mmHg, respectively). * p < 0.05, ** p < 0.01 vs. 0 mmHg. (B) Representative traces (pulse protocol, inset), corresponding current-voltage relationship, mean data for voltage dependence activation, inactivation, and time course of recovery current for I Ca,L ( n = 8–18 at 0, 20, and 40 mmHg, respectively). * p < 0.05, ** p < 0.01 vs. 0 mmHg. (C) Representative western blots and densitometric analysis of Cav1.2, Piezo1, CaM, and Src in HL-1 cells under various hydrostatic pressure (0, 20, and 40 mmHg) for 24 h. GAPDH was used as an internal control. Values are presented as the mean ± SEM.

Article Snippet: According to standard protocols, the treated protein samples (15–30 μg) were separated by electrophoresis with 10% SDS–polyacrylamide gels and transferred to PVDF membranes, which were blocked with 5% non-fat milk for 1 h at room temperature and then incubated overnight at 4°C with primary rabbit polyclonal Abs against Piezo1, Cav1.2 (dilution, 1:1000; Alomone Labs, Jerusalem, Israel); and Src (1:1000; Abcam, Waltham, MA, USA;) and mouse polyclonal Abs against Pitx2 (1:1000; Cloud-Clone Corp., Wuhan, Hubei, China) and glyceraldehyde 3-phosphate dehydrogenase (GAPDH) or β-actin (1:5000; Cell Signaling Technology, Inc., Beverly, MA, USA).

Techniques: Activation Assay, Western Blot

Journal: Frontiers in Cardiovascular Medicine

Article Title: Piezo1 Participated in Decreased L-Type Calcium Current Induced by High Hydrostatic Pressure via . CaM/Src/Pitx2 Activation in Atrial Myocytes

doi: 10.3389/fcvm.2022.842885

Figure Lengend Snippet: The effects of Piezo1 on perceiving HHP and mediating the decrease of I Ca,L . (A,B) Representative Ca 2+ traces and Δ Ca i 2 + (ΔF/F) are shown. Ca 2+ entry was evoked by 10 μm Yoda1 in HL-1 cells stimulated by HHP in the presence or absence of the Piezo1 inhibitor GsmTx4 ( n = 50) or siRNA specifically knockdown Piezo1 ( n = 53–58). si-C, scrambled (control) siRNA; si-P, siRNA directed against Piezo1. (C) Representative traces of AP in HL-1 cells stimulated by 40 mmHg pressure with and without GsmTx4 treatment (3.0 μM) and APD 50 , APD 70 , and APD 90 of HL-1 cells were calculated ( n = 9, 7, and 11 at 0, 40, and 40 mmHg + GsmTx4). * p < 0.05, ** p < 0.01 vs. 0 mmHg; # p < 0.05 vs. 40 mmHg. (D) Representative traces (pulse protocol, inset), corresponding current–voltage relationship, mean data for voltage dependence activation, inactivation, and time course of recovery current for I Ca,L in HL-1 cells stimulated by 40 mmHg pressure with and without GsmTx4 treatment ( n = 9–15). ** p < 0.01 vs. 0 mmHg; ## p < 0.01 vs. 40 mmHg. (E) Representative blots and densitometry analysis of Cav1.2 in HL-1 cells stimulated by 40 mmHg pressure with and without GsmTx4 treatment. (F) Representative blots and densitometry analysis of Cav1.2 in Yoda1 stimulation at different dosages (1, 3, and 10 μM) for 48 h. GAPDH was used as an internal control. Values are presented as the mean ± SEM.

Article Snippet: According to standard protocols, the treated protein samples (15–30 μg) were separated by electrophoresis with 10% SDS–polyacrylamide gels and transferred to PVDF membranes, which were blocked with 5% non-fat milk for 1 h at room temperature and then incubated overnight at 4°C with primary rabbit polyclonal Abs against Piezo1, Cav1.2 (dilution, 1:1000; Alomone Labs, Jerusalem, Israel); and Src (1:1000; Abcam, Waltham, MA, USA;) and mouse polyclonal Abs against Pitx2 (1:1000; Cloud-Clone Corp., Wuhan, Hubei, China) and glyceraldehyde 3-phosphate dehydrogenase (GAPDH) or β-actin (1:5000; Cell Signaling Technology, Inc., Beverly, MA, USA).

Techniques: Activation Assay

Journal: Frontiers in Cardiovascular Medicine

Article Title: Piezo1 Participated in Decreased L-Type Calcium Current Induced by High Hydrostatic Pressure via . CaM/Src/Pitx2 Activation in Atrial Myocytes

doi: 10.3389/fcvm.2022.842885

Figure Lengend Snippet: Effect of CaM/Src on the decrease of I Ca,L induced by HHP or Yoda1 stimulation. (A) Representative blots and densitometry analysis of CaM and Src in HL-1 cells stimulated by 40 mmHg pressure with and without GsmTx4 treatment. (B) Representative blots and densitometry analysis of CaM and Src in Yoda1 stimulation at different dosages (1, 3, and 10 μM) for 48 h. (C) Representative blots and densitometry analysis of Src and p-Src ( n = 4) in HL-1 cells transfected with scrambled (control) siRNA or siRNA directed against Piezo1 for 48 h, then treated with Yoda1 at different dosages (0, 1, and 3 μM) for 15 min. (D) Representative traces of AP and histogram of APD in HL-1 cells ( n = 7–8). * p < 0.05 vs. 0 mmHg + DMSO. # p < 0.05 vs. 40 mmHg + DMSO. (E) Current–voltage relationship for I Ca,L ( n = 9–17) in HL-1 cells stimulated by 40 mmHg pressure treated with 15 μM PP1 or W7. * p < 0.05 vs. 0 mmHg + DMSO. # p < 0.05 vs. 40 mmHg + DMSO. (F) Representative blots and densitometry analysis of Cav1.2 and Src in HL-1 cells stimulated by 40 mmHg pressure treated with W7 under different concentrations (5, 10, 15, and 20 μM). (G) Representative blots and densitometry analysis of Cav1.2 in HL-1 cells stimulated by 40 mmHg pressure treated with PP1 (15 μM). (H) Current-voltage relationship for I Ca,L ( n = 8–10) in HL-1 cells stimulated by Yoda1(3 μM) treated with PP1. * p < 0.05, ** p < 0.01 vs. DMSO. # p < 0.05, ## p < 0.01 vs. Yoda1. (I) Representative blots and densitometry analysis of Cav1.2 in Yoda1(3μM) -stimulated HL-1 cells treated with PP1 (15 μM). GAPDH was used as an internal control. Values are presented as the mean ± SEM.

Article Snippet: According to standard protocols, the treated protein samples (15–30 μg) were separated by electrophoresis with 10% SDS–polyacrylamide gels and transferred to PVDF membranes, which were blocked with 5% non-fat milk for 1 h at room temperature and then incubated overnight at 4°C with primary rabbit polyclonal Abs against Piezo1, Cav1.2 (dilution, 1:1000; Alomone Labs, Jerusalem, Israel); and Src (1:1000; Abcam, Waltham, MA, USA;) and mouse polyclonal Abs against Pitx2 (1:1000; Cloud-Clone Corp., Wuhan, Hubei, China) and glyceraldehyde 3-phosphate dehydrogenase (GAPDH) or β-actin (1:5000; Cell Signaling Technology, Inc., Beverly, MA, USA).

Techniques: Transfection

Journal: Frontiers in Cardiovascular Medicine

Article Title: Piezo1 Participated in Decreased L-Type Calcium Current Induced by High Hydrostatic Pressure via . CaM/Src/Pitx2 Activation in Atrial Myocytes

doi: 10.3389/fcvm.2022.842885

Figure Lengend Snippet: Schematic representation of the mechanism for the decrease of I Ca,L induced by HHP. Piezo1 activated by HHP depressed I Ca,L contributing to increased AF susceptibility through the CaM/Src/Pitx2 pathway.

Article Snippet: According to standard protocols, the treated protein samples (15–30 μg) were separated by electrophoresis with 10% SDS–polyacrylamide gels and transferred to PVDF membranes, which were blocked with 5% non-fat milk for 1 h at room temperature and then incubated overnight at 4°C with primary rabbit polyclonal Abs against Piezo1, Cav1.2 (dilution, 1:1000; Alomone Labs, Jerusalem, Israel); and Src (1:1000; Abcam, Waltham, MA, USA;) and mouse polyclonal Abs against Pitx2 (1:1000; Cloud-Clone Corp., Wuhan, Hubei, China) and glyceraldehyde 3-phosphate dehydrogenase (GAPDH) or β-actin (1:5000; Cell Signaling Technology, Inc., Beverly, MA, USA).

Techniques:

Journal: Frontiers in endocrinology

Article Title: Examination of the mechanism of Piezo ion channel in 5-HT synthesis in the enterochromaffin cell and its association with gut motility.

doi: 10.3389/fendo.2023.1193556

Figure Lengend Snippet: FIGURE 3 The addition of 10 nM GsMTx4 for 8 h alters the expression of Piezo channels. (A) Western blotting experiments of Piezo channels and quantified values (Mean ± SEM, *P<0.05, **P<0.01). (B) RT-qPCR experiments of Piezo channels (Mean ± SEM, *P<0.05). (C) Immunofluorescence analysis of Piezo1 channels. Nuclei were stained with Hoechst dye.The histogram quantifies the fluorescence intensity (Mean ± SEM, ***P<0.001). (D) Immunofluorescence analysis of Piezo2 channels. Nuclei were stained with Hoechst dye.The histogram quantifies the fluorescence intensity (Mean ± SEM, *P<0.05).

Article Snippet: Gene sequence ACTB-F GAGACCGCGTCCGCC ACTB-R ATCATCCATGGTGAGCTGGC TPH1-F CCCTTTGATCCCAAGATTAC TPH1-R CATTCATGGCACTGGTTATG PIEZO1-F ATCGCCATCATCTGGTTCCC PIEZO1-R TGGTGAACAGCGGCTCATAG PIEZO2-F TGGACACCATTGACGAGCAT PIEZO2-R CTTCAGTGTAGCAGCTGGAGAT PKCA-F GTCCACAAGAGGTGCCATGAA PKCA-R AAGGTGGGGCTTCCGTAAGT IP3R-F GCGGAGGGATCGACAAATGG IP3R-R TGGGACATAGCTTAAAGAGGCA MAPK-F TACACCAACCTCTCGTACATCG MAPK-R CATGTCTGAAGCGCAGTAAGATT AMPK-F TTGAAACCTGAAAATGTCCTGCT AMPK-R GGTGAGCCACAACTTGTTCTT frontiersin.org antibody: TPH1 (T0678, 1:200; Merck), Piezo1 (NBP1-78537, 1:200; Novus), Piezo2 (NBP1-78624, 1:200; Novus).

Techniques: Expressing, Western Blot, Quantitative RT-PCR, Staining

Journal: Frontiers in endocrinology

Article Title: Examination of the mechanism of Piezo ion channel in 5-HT synthesis in the enterochromaffin cell and its association with gut motility.

doi: 10.3389/fendo.2023.1193556

Figure Lengend Snippet: FIGURE 7 Diagram of the main content of this article (created with biorender.com). GsMTx4 can inhibit the increase of intracellular calcium induced by mechanical stimulation, leading to a decrease in the protein expression of Piezo1 and Piezo2, and an increase in the protein expression of TPH1. During this process, the phosphorylation level of p38 protein increases. At the same time, there is an increase in the secretion of 5-HT. However, there is no sufficient evidence supporting the association between the changes in Piezo1/2 and TPH1 proteins and p38 protein phosphorylation. Additionally, the mechanism underlying the increased 5-HT secretion also requires further experimental research.

Article Snippet: Gene sequence ACTB-F GAGACCGCGTCCGCC ACTB-R ATCATCCATGGTGAGCTGGC TPH1-F CCCTTTGATCCCAAGATTAC TPH1-R CATTCATGGCACTGGTTATG PIEZO1-F ATCGCCATCATCTGGTTCCC PIEZO1-R TGGTGAACAGCGGCTCATAG PIEZO2-F TGGACACCATTGACGAGCAT PIEZO2-R CTTCAGTGTAGCAGCTGGAGAT PKCA-F GTCCACAAGAGGTGCCATGAA PKCA-R AAGGTGGGGCTTCCGTAAGT IP3R-F GCGGAGGGATCGACAAATGG IP3R-R TGGGACATAGCTTAAAGAGGCA MAPK-F TACACCAACCTCTCGTACATCG MAPK-R CATGTCTGAAGCGCAGTAAGATT AMPK-F TTGAAACCTGAAAATGTCCTGCT AMPK-R GGTGAGCCACAACTTGTTCTT frontiersin.org antibody: TPH1 (T0678, 1:200; Merck), Piezo1 (NBP1-78537, 1:200; Novus), Piezo2 (NBP1-78624, 1:200; Novus).

Techniques: Expressing, Phospho-proteomics

Journal: Proceedings of the National Academy of Sciences of the United States of America

Article Title: Membrane stretch as the mechanism of activation of PIEZO1 ion channels in chondrocytes.

doi: 10.1073/pnas.2221958120

Figure Lengend Snippet: Fig. 1. Role of PIEZO1 and PIEZO2 in primary porcine chondrocytes during mechanical or pharmacologic activation. (A) Immunohistochemistry staining for PIEZO1 (red), PIEZO2 (yellow), and DAPI (blue). (Scale bar: 5 µm.) (B) mRNA levels of PIEZO1 (P1) and PIEZO2 (P2) normalized to ACTB expression level in nontargeting control (NTC) and P1-siRNA or P2-siRNA. (C) Protein levels of PIEZO1 (Left) and PIEZO2 (Right) in NTC and P1-siRNA or P2-siRNA chondrocytes. (D) AFM loading response of P1-siRNA cells compared to their respective NTCs showing representative cell signaling trend, normalized intracellular Ca2+ fluorescence intensity ΔFmax/F, the percentage of the responding cells, and deformation. (E) Confocal imaging results of Yoda1 stimulation of P1-siRNA cells compared to their respective NTCs showing representative cell signaling trend, normalized intracellular Ca2+ fluorescence intensity ΔFmax/F, and the percentage of responding cells. Similarly, results for P2-siRNA cells (F) AFM loading and (G) confocal imaging. Data presented as mean ± SEM. For B, n = 8 samples; for D and F, percentage of responders, n = 4 to 5 test batches, for applied deformation and Ca2+ response to AFM mechanical loading, n = 73 to 96 cells; For E and G, n = 9 to 21 tested wells; for group comparison B, D–G, t test, *P < 0.05, **P < 0.005, ***P < 0.001, ****P < 0.0001.

Article Snippet: Last, samples were labeled with conjugated rabbit PIEZO1 and PIEZO2 antibodies overnight (1:25, Novus Biologicals).

Techniques: Activation Assay, Immunohistochemistry, Staining, Expressing, Control, Fluorescence, Imaging, Comparison

Journal: Proceedings of the National Academy of Sciences of the United States of America

Article Title: Membrane stretch as the mechanism of activation of PIEZO1 ion channels in chondrocytes.

doi: 10.1073/pnas.2221958120

Figure Lengend Snippet: Fig. 6. Schematic of the mechanism involved in PIEZO1 activation in response to membrane tension. As the cell is deformed and experiences tensile strains in the peripheral regions, the cell plasma membrane initially experiences unfolding. After the ruffles are unfolded, then the plasma membrane will experience local tensile strains. However, swelling of the cell with (A) hypoosmotic stress unfolds the ruffles prior to loading and exposes more PIEZO channels to the extracellular cues before mechanical compression, resulting in higher levels of intracellular Ca2+ signaling in the chondrocytes in response to mechanical compression compared to the (B) isoosmotically treated group. (C) On the other hand, applying a hyperosmotic stress decreases the cell size and increases membrane ruffling. Therefore, more deformation is required to unfold the membrane curvatures before inducing stretch of the plasma membrane. Consequently, the force and deformation necessary to unfold the membrane curvatures increase compared to the isoosmotically treated group. This change results in a smaller portion of the force being dedicated to compressing the cell and decreases the sensitivity of the PIEZO channel to mechanical compression.

Article Snippet: Last, samples were labeled with conjugated rabbit PIEZO1 and PIEZO2 antibodies overnight (1:25, Novus Biologicals).

Techniques: Activation Assay, Membrane, Clinical Proteomics

Journal: Proceedings of the National Academy of Sciences of the United States of America

Article Title: Membrane stretch as the mechanism of activation of PIEZO1 ion channels in chondrocytes.

doi: 10.1073/pnas.2221958120

Figure Lengend Snippet: Fig. 5. Ca2+ signaling of chondrocytes in response to different mechanical loading rates in the presence of PIEZO1 nonspecific inhibitor GsMTx-4 and Ca2+ inhibitors thapsigargin and EGTA. (A) Applied deformation (%). (B) Intracellular Ca2+ fluorescence intensity ΔFmax/F, with Inset showing representative signaling trends. (C) Percentage of responding cells. Data presented as mean ± SEM. For group comparison A and B, one-way ANOVA with Tukey’s post hoc test, different letters indicate statistical significance P < 0.05 with no significance found in A, n = 12 to 42 cells.

Article Snippet: Last, samples were labeled with conjugated rabbit PIEZO1 and PIEZO2 antibodies overnight (1:25, Novus Biologicals).

Techniques: Fluorescence, Comparison